miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002083
Located between position 28005009 and 28005090 on chromosome 4 strand +
mature miRNAs for MI0002083:
         dre-miR-430c (MIMAT0001425): TAAGTGCTTCTCTTTGGGGTAG
You can find this miRNA in ENTREZGENE: mir430c-6 (accession: 100033797)

References
[1]Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF, Science. 308:833-838(2005)., "MicroRNAs regulate brain morphogenesis in zebrafish"
[2]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"