| Basic information from miRBase |
| hairpin accession number: MI0001595 |
| Located between position 642193 and 642277 on chromosome Group11.33 strand - |
| mature miRNAs for MI0001595: |
| ame-miR-8 (MIMAT0001490): TAATACTGTCAGGTAAAGATGTC |
| You can find this miRNA in ENTREZGENE: Mir8 (accession: 732511) |
| References |
| [1]Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F, Insect Mol Biol. 19:799-805(2010)., "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" |