| Basic information from miRBase |
| hairpin accession number: MI0015766 |
| Located between position 2705812 and 2705877 on chromosome 9p strand + |
| Overlapping with sense strand of (intron 14). |
| (Ensemble: ENSCINT00000011521) |
| mature miRNAs for MI0015766: |
| cin-miR-4209-5p (MIMAT0016830): TAATGATTAGTATGTGGCTT |
| You can find this miRNA in ENTREZGENE: mir4209 (accession: 100499011) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |