| Basic information from miRBase |
| hairpin accession number: MI0009812 |
| Located between position 18298065 and 18298175 on chromosome 19 strand - |
| mature miRNAs for MI0009812: |
| bta-miR-365-3p (MIMAT0004341): TAATGCCCCTAAAAATCCTTAT |
| You can find this miRNA in ENTREZGENE: MIR365-2 (accession: 100313311) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |
| [2]Jin W, Grant JR, Stothard P, Moore SS, Guan LL, BMC Mol Biol. 10:90(2009)., "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" |