miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000767
Located between position 14403142 and 14403228 on chromosome 16 strand +
mature miRNAs for MI0000767:
         hsa-miR-365 (MIMAT0000710): TAATGCCCCTAAAAATCCTTAT
You can find this miRNA in EMBL: AY882279 (accession: AY882279)

References
[1]Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
[2]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs"
[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[4]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"


PROMOTER INFORMATION
PROMOTER ID
LOCALIZATION
SEQUENCE
REFERENCE
SNP
TFBS
218 chr16, 14303600-14303800, + promoter sequence Marson et al.
219 chr16, 14309182-14309534, + promoter sequence Marson et al.
220 chr16, 14309748-14312532, + promoter sequence Marson et al.
1060 chr16, 14305643-14310729, + promoter sequence UCSC
1380 chr16, 14299813-14304812, + promoter sequence Ozsolak et al. (MALME)
1400 chr16, 14299773-14304772, + promoter sequence Ozsolak et al. (MCF7)
1588 chr16, 14299813-14304812, + promoter sequence Ozsolak et al. (UACC62)


more data
Expression data from dbDEMC
Expression data from PhenomiR