| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005326 |
| Located between position 108690913 and 108690999 on chromosome 6 strand + |
| mature miRNAs for MI0005326: |
| mdo-miR-365 (MIMAT0004137): TAATGCCCCTAAAAATCCTTAT |
| You can find this miRNA in ENTREZGENE: Mir365 (accession: 100034263) |
| References |
| [1]Devor EJ, Samollow PB, J Hered. 99:66-72(2008)., "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" |
| more data |
| Data from CoGemiR |