| Basic information from miRBase |
| hairpin accession number: MI0008636 |
| Located between position 14737304 and 14737389 on chromosome 16 strand + |
| mature miRNAs for MI0008636: |
| ptr-miR-365 (MIMAT0008117): TAATGCCCCTAAAAATCCTTAT |
| You can find this miRNA in ENTREZGENE: MIR365-1 (accession: 100316382) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |