Basic information from miRBase |
hairpin accession number: MI0008637 |
Located between position 25696885 and 25696994 on chromosome 17 strand - |
mature miRNAs for MI0008637: |
ptr-miR-365 (MIMAT0008117): TAATGCCCCTAAAAATCCTTAT |
You can find this miRNA in ENTREZGENE: MIR365-2 (accession: 100316463) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |