miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008637
Located between position 25696885 and 25696994 on chromosome 17 strand -
mature miRNAs for MI0008637:
         ptr-miR-365 (MIMAT0008117): TAATGCCCCTAAAAATCCTTAT
You can find this miRNA in ENTREZGENE: MIR365-2 (accession: 100316463)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"