| Basic information from miRBase |
| hairpin accession number: MI0011855 |
| Located between position 5603855 and 5604141 on chromosome MtChr6 strand + |
| mature miRNAs for MI0011855: |
| mtr-miR2604 (MIMAT0013308): TAATTTTTATGTGGGAGTGTT |
| References |
| [1]Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M, Plant Cell. 21:2780-2796(2009)., "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" |