| Basic information from miRBase |
| hairpin accession number: MI0017449 |
| Located between position 37243532 and 37243613 on chromosome 4 strand - |
| mature miRNAs for MI0017449: |
| hsa-miR-4801 (MIMAT0019980): TACACAAGAAAACCAAGGCTCA |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |