Basic information from miRBase |
hairpin accession number: MI0007995 |
Located between position 96260667 and 96260721 on chromosome 1 strand + |
Overlapping with sense strand of XM_541299.2 (intron 8). |
(Ensemble: ENSCAFT00000003309) |
mature miRNAs for MI0007995: |
cfa-miR-101 (MIMAT0006600): TACAGTACTGTGATAACTGA |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" |