| Basic information from miRBase |
| hairpin accession number: MI0000739 |
| Located between position 4850297 and 4850375 on chromosome 9 strand + |
| Overlapping with sense strand of RCL1-006 (intron 4). |
| (Ensemble: OTTHUMT00000051592) |
| mature miRNAs for MI0000739: |
| hsa-miR-101 (MIMAT0000099): TACAGTACTGTGATAACTGAA |
| You can find this miRNA in EMBL: AF480540 (accession: AF480540) |
| References | ||||||||||||||
[1]Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"  | ||||||||||||||
| [2]Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" | ||||||||||||||
| [3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| [4]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 422 | chr9, 4782836-4783036, + | promoter sequence | Marson et al. |  | | |||||||||
| 423 | chr9, 4830304-4830504, + | promoter sequence | Marson et al. | | | |||||||||
| 767 | chr9, 4835297-4840375, + | promoter sequence | UCSC | | | |||||||||
| 1272 | chr9, 4823281-4828280, + | promoter sequence | Corcoran et al. | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |