| Basic information from miRBase |
| hairpin accession number: MI0008408 |
| Located between position 4952515 and 4952592 on chromosome 9 strand + |
| Overlapping with sense strand of XM_520471.2 (intron 8). |
| (Ensemble: ENSPTRT00000038388) |
| mature miRNAs for MI0008408: |
| ptr-miR-101 (MIMAT0002430): TACAGTACTGTGATAACTGAAG |
| You can find this miRNA in ENTREZGENE: MIR101-2 (accession: 100316038) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |