| Basic information from miRBase |
| hairpin accession number: MI0008792 |
| Located between position 56085447 and 56085543 on chromosome 5 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSPTRT00000064561) |
| mature miRNAs for MI0008792: |
| ptr-miR-582 (MIMAT0008255): TACAGTTGTTCAACCAGTTACTA |
| You can find this miRNA in ENTREZGENE: MIR582 (accession: 100316234) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |