| Basic information from miRBase |
| hairpin accession number: MI0017450 |
| Located between position 40504057 and 40504136 on chromosome 4 strand - |
| Overlapping with sense strand of RBM47-010 (intron 2). |
| (Ensemble: OTTHUMT00000362033) |
| mature miRNAs for MI0017450: |
| hsa-miR-4802-5p (MIMAT0019981): TATGGAGGTTCTAGACCATGTT |
| hsa-miR-4802-3p (MIMAT0019982): TACATGGATGGAAACCTTCAAGC |
| References |
| [1]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |