| Basic information from miRBase |
| hairpin accession number: MI0015752 |
| Located between position 1466427 and 1466482 on chromosome 13q strand + |
| mature miRNAs for MI0015752: |
| cin-miR-4195-3p (MIMAT0016814): TACATGTAATACATTGGCTT |
| You can find this miRNA in ENTREZGENE: mir4195 (accession: 100499002) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |