| Basic information from miRBase |
| hairpin accession number: MI0007630 |
| Located between position 68318877 and 68318976 on chromosome 20 strand + |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSMMUT00000004724) |
| mature miRNAs for MI0007630: |
| mml-miR-140-5p (MIMAT0006197): CAGTGGTTTTACCCTATGGTAG |
| mml-miR-140-3p (MIMAT0006198): TACCACAGGGTAGAACCACGG |
| You can find this miRNA in ENTREZGENE: MIR140 (accession: 100315200) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |