| Basic information from miRBase |
| hairpin accession number: MI0012983 |
| Located between position 40076530 and 40076626 on chromosome X strand + |
| Overlapping with sense strand of LOC100052289 (intron 1). |
| (Ensemble: ENSECAT00000011707) |
| mature miRNAs for MI0012983: |
| eca-miR-660 (MIMAT0013241): TACCCATTGCATATCGGAGTTG |
| You can find this miRNA in ENTREZGENE: MIR660 (accession: 100315097) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |