miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011070
Located between position 489184 and 489298 on chromosome Crem_Contig43 strand +
mature miRNAs for MI0011070:
         crm-miR-55* (MIMAT0011551): CGGCAGAAGCACTTGGGGTAT
         crm-miR-55 (MIMAT0011552): TACCCGTATTTGTTTCTGCTGAG

References
[1]de Wit E, Linsen SE, Cuppen E, Berezikov E, Genome Res. 19:2064-2074(2009)., "Repertoire and evolution of miRNA genes in four divergent nematode species"