| Basic information from miRBase |
| hairpin accession number: MI0008411 |
| Located between position 181155490 and 181155598 on chromosome 2b strand + |
| mature miRNAs for MI0008411: |
| ptr-miR-10b (MIMAT0007945): TACCCTGTAGAACCGAATTTGTG |
| You can find this miRNA in ENTREZGENE: MIR10B (accession: 100316040) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |