| Basic information from miRBase |
| hairpin accession number: MI0008410 |
| Located between position 9157676 and 9157784 on chromosome 17 strand + |
| mature miRNAs for MI0008410: |
| ptr-miR-10a (MIMAT0007944): TACCCTGTAGATCCGAATTTGTG |
| You can find this miRNA in ENTREZGENE: MIR10A (accession: 100316422) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |