| Basic information from miRBase |
| hairpin accession number: MI0014669 |
| Located between position 2184135 and 2184629 on chromosome 4 strand + |
| mature miRNAs for MI0014669: |
| ath-miR841b (MIMAT0017741): TACGAGCCACTGGAAACTGAA |
| ath-miR841b* (MIMAT0017742): CAATTTCTAGTGGGTCGTATT |
| References |
| [1]Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC, Plant Cell. 22:1074-1089(2010)., "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" |