miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013146
Located between position 97562457 and 97562536 on chromosome X strand -
Overlapping with sense strand of (intron 2).
(Ensemble: ENSSSCT00000013816)
mature miRNAs for MI0013146:
         ssc-miR-1277 (MIMAT0013935): TACGTAGATATATATGTATTTT
You can find this miRNA in ENTREZGENE: MIR1277 (accession: 100498736)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"