miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012678
Located between position 59091270 and 59091342 on chromosome 2 strand -
Overlapping with sense strand of LOC100062282 (intron 1).
(Ensemble: ENSECAT00000014582)
mature miRNAs for MI0012678:
         eca-miR-598 (MIMAT0012922): TACGTCATCGTTGTCATCGTCA
You can find this miRNA in ENTREZGENE: MIR598 (accession: 100314791)

References
[1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach"