| Basic information from miRBase |
| hairpin accession number: MI0008804 |
| Located between position 6286794 and 6286889 on chromosome 8_random strand - |
| Overlapping with sense strand of Q49LS2_PANTR (intron 1). |
| (Ensemble: ENSPTRT00000055923) |
| mature miRNAs for MI0008804: |
| ptr-miR-598 (MIMAT0008267): TACGTCATCGTTGTCATCGTCA |
| You can find this miRNA in ENTREZGENE: MIR598 (accession: 100316240) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |