| PROMOTER INFORMATION | ||||||||||||||
| 79 | chrX, 146161661-146162010, - | promoter sequence | Zhou et al. |  | | |||||||||
| 863 | chrX, 146161545-146166618, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0003197 |
| Located between position 146353853 and 146353926 on chromosome X strand - |
| mature miRNAs for MI0003197: |
| hsa-miR-510 (MIMAT0002882): TACTCAGGAGAGTGGCAATCAC |
| You can find this miRNA in EMBL: AY882334 (accession: AY882334) |
| References | ||||||||||||||
| [1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 79 | chrX, 146161661-146162010, - | promoter sequence | Zhou et al. | | | |||||||||
| 863 | chrX, 146161545-146166618, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |