| Basic information from miRBase |
| hairpin accession number: MI0012976 |
| Located between position 116765762 and 116765878 on chromosome X strand - |
| mature miRNAs for MI0012976: |
| eca-miR-508-5p (MIMAT0013231): TACTCCAGAGGGTGTCATTCACA |
| eca-miR-508-3p (MIMAT0013232): TGATTGTCACCTTTTGGAGTAGA |
| You can find this miRNA in ENTREZGENE: MIR508 (accession: 100314953) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |