miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011327
Located between position 75494398 and 75494452 on chromosome 14 strand -
Overlapping with sense strand of SNORA61 (exon 1).
(Ensemble: ENSBTAT00000060503) RFAM: RFAM)
mature miRNAs for MI0011327:
         bta-miR-2311 (MIMAT0011826): TACTGAAACTGTGCTCGTGGTGT
You can find this miRNA in ENTREZGENE: MIR2311 (accession: 100313132)

References
[1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"