| Basic information from miRBase |
| hairpin accession number: MI0008583 |
| Located between position 57299675 and 57299783 on chromosome 2a strand - |
| mature miRNAs for MI0008583: |
| ptr-miR-217 (MIMAT0008073): TACTGCATCAGGAACTGATTGGA |
| You can find this miRNA in ENTREZGENE: MIR217 (accession: 100316377) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |