| Basic information from miRBase |
| hairpin accession number: MI0008788 |
| Located between position 118215854 and 118215948 on chromosome 4 strand + |
| Overlapping with sense strand of XM_001146745.1 (intron 2). |
| (Ensemble: ENSPTRT00000030479) |
| mature miRNAs for MI0008788: |
| ptr-miR-577 (MIMAT0008251): TAGATAAAATATTGGTACCTG |
| You can find this miRNA in ENTREZGENE: MIR577 (accession: 100316232) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |