| Basic information from miRBase |
| hairpin accession number: MI0008595 |
| Located between position 188208702 and 188208788 on chromosome 1 strand - |
| mature miRNAs for MI0008595: |
| ptr-miR-29c (MIMAT0008082): TAGCACCATTTGAAATCGGTTA |
| You can find this miRNA in ENTREZGENE: MIR29C (accession: 100316129) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |