| Basic information from miRBase |
| hairpin accession number: MI0015483 |
| Located between position 4571603 and 4571655 on chromosome 7q strand - |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSCINT00000007545) |
| mature miRNAs for MI0015483: |
| cin-miR-15-5p (MIMAT0016397): TAGCAGCACACAAAACTATC |
| cin-miR-15-3p (MIMAT0016398): CTGGTTTCTGTGAGCTGCTT |
| You can find this miRNA in ENTREZGENE: mir15 (accession: 100498862) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |