| Basic information from miRBase |
| hairpin accession number: MI0007658 |
| Located between position 6730526 and 6730612 on chromosome 16 strand - |
| mature miRNAs for MI0007658: |
| mml-miR-195 (MIMAT0006228): TAGCAGCACAGAAATATTGGC |
| You can find this miRNA in ENTREZGENE: MIR195 (accession: 100315450) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |