| Basic information from miRBase |
| hairpin accession number: MI0008568 |
| Located between position 7177858 and 7177943 on chromosome 17 strand - |
| mature miRNAs for MI0008568: |
| ptr-miR-195 (MIMAT0008060): TAGCAGCACAGAAATATTGGC |
| You can find this miRNA in ENTREZGENE: MIR195 (accession: 100316323) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |