miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002495
Located between position 165480590 and 165480687 on chromosome 3 strand +
Overlapping with sense strand of (intron 4).
(Ensemble: ENSPTRT00000029056)
mature miRNAs for MI0002495:
         ptr-miR-15b (MIMAT0002206): TAGCAGCACATCATGGTTTACA
You can find this miRNA in EMBL: AY865833 (accession: AY865833)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"