Basic information from miRBase |
hairpin accession number: MI0002495 |
Located between position 165480590 and 165480687 on chromosome 3 strand + |
Overlapping with sense strand of (intron 4). |
(Ensemble: ENSPTRT00000029056) |
mature miRNAs for MI0002495: |
ptr-miR-15b (MIMAT0002206): TAGCAGCACATCATGGTTTACA |
You can find this miRNA in EMBL: AY865833 (accession: AY865833) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |