| Basic information from miRBase |
| hairpin accession number: MI0008555 |
| Located between position 165480748 and 165480827 on chromosome 3 strand + |
| Overlapping with sense strand of (intron 4). |
| (Ensemble: ENSPTRT00000029056) |
| mature miRNAs for MI0008555: |
| ptr-miR-16 (MIMAT0002655): TAGCAGCACGTAAATATTGGCG |
| You can find this miRNA in ENTREZGENE: MIR16-2 (accession: 100316108) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |