| Basic information from miRBase |
| hairpin accession number: MI0010454 |
| Located between position 73969851 and 73969931 on chromosome 16 strand + |
| Overlapping with antisense strand of A6QNU3_BOVIN (intron 1). |
| (Ensemble: ENSBTAT00000007107) |
| mature miRNAs for MI0010454: |
| bta-miR-29e (MIMAT0009953): TAGCATCATTTGAAATCAGTGTTT |
| You can find this miRNA in ENTREZGENE: MIR29E (accession: 100313099) |
| References |
| [1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |