miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0009955
Located between position 48225991 and 48226087 on chromosome 4 strand -
Overlapping with sense strand of Erp44-001 (intron 6).
(Ensemble: OTTMUST00000015705)
mature miRNAs for MI0009955:
         mmu-miR-1958 (MIMAT0009431): TAGGAAAGTGGAAGCAGTAAGT
You can find this miRNA in MGI: Mir1958 (accession: 3837123)

References
[1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model"