| Basic information from miRBase |
| hairpin accession number: MI0015558 |
| Located between position 3011 and 3059 on chromosome scaffold_4930 strand + |
| mature miRNAs for MI0015558: |
| cin-miR-4013b-5p (MIMAT0016516): TTACTTGCTTTAACAGTATG |
| cin-miR-4013b-3p (MIMAT0016517): TAGGCTGCTAATGCAAGC |
| You can find this miRNA in ENTREZGENE: mir4013b (accession: 100499058) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |