| Basic information from miRBase |
| hairpin accession number: MI0015557 |
| Located between position 845403 and 845456 on chromosome scaffold_44 strand + |
| mature miRNAs for MI0015557: |
| cin-miR-4013a-5p (MIMAT0016514): AGACTTGTAATAGCAGCATG |
| cin-miR-4013a-3p (MIMAT0016515): TAGGCTGCTAATGCAAGCCC |
| You can find this miRNA in ENTREZGENE: mir4013a (accession: 100498900) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |