Basic information from miRBase |
hairpin accession number: MI0001190 |
Located between position 32586149 and 32586242 on chromosome 2 strand - |
Overlapping with antisense strand of (intron 1). |
(Ensemble: ENSGALT00000035376) |
mature miRNAs for MI0001190: |
gga-miR-196 (MIMAT0001121): TAGGTAGTTTCATGTTGTTGG |
You can find this miRNA in ENTREZGENE: (accession: 777944) |
References |
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
[2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
more data |
Data from CoGemiR |