miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001190
Located between position 32586149 and 32586242 on chromosome 2 strand -
Overlapping with antisense strand of (intron 1).
(Ensemble: ENSGALT00000035376)
mature miRNAs for MI0001190:
         gga-miR-196 (MIMAT0001121): TAGGTAGTTTCATGTTGTTGG
You can find this miRNA in ENTREZGENE: (accession: 777944)

References
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
[2]McBride D, Carre W, Law A, Clinton M, Unpublished.,


more data
Data from CoGemiR