miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008569
Located between position 9101831 and 9101899 on chromosome 17 strand +
mature miRNAs for MI0008569:
         ptr-miR-196a (MIMAT0002522): TAGGTAGTTTCATGTTGTTGGG
You can find this miRNA in ENTREZGENE: MIR196A-1 (accession: 100316115)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"