Basic information from miRBase |
hairpin accession number: MI0008569 |
Located between position 9101831 and 9101899 on chromosome 17 strand + |
mature miRNAs for MI0008569: |
ptr-miR-196a (MIMAT0002522): TAGGTAGTTTCATGTTGTTGGG |
You can find this miRNA in ENTREZGENE: MIR196A-1 (accession: 100316115) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |