| Basic information from miRBase |
| hairpin accession number: MI0008570 |
| Located between position 27513878 and 27513960 on chromosome 7 strand - |
| Overlapping with sense strand of (exon 4). |
| (Ensemble: ENSPTRT00000035158) |
| mature miRNAs for MI0008570: |
| ptr-miR-196b (MIMAT0008061): TAGGTAGTTTCCTGTTGTTGGG |
| You can find this miRNA in ENTREZGENE: MIR196B (accession: 100316450) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |