miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015604
Located between position 627148 and 627209 on chromosome scaffold_55 strand -
mature miRNAs for MI0015604:
         cin-miR-4053-5p (MIMAT0016595): CGCCGGGGTATGACGTCGT
         cin-miR-4053-3p (MIMAT0016596): TAGTACGTCGTTCTCCGGACGG
You can find this miRNA in ENTREZGENE: mir4053 (accession: 100498925)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"