miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0011293
Located between position 5343246 and 5343321 on chromosome 3R strand +
Overlapping with sense strand of CG8176-RA (intron 1).
(Ensemble: FBtr0082065) (FlyBase: FlyBase)
mature miRNAs for MI0011293:
         dme-miR-2283-5p (MIMAT0011791): GAAAATATCATGAATACGACAAT
         dme-miR-2283-3p (MIMAT0020909): TAGTATACGTGATATTTTAGG

References
[1]Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC, Genome Res. 19:1776-1785(2009)., "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line"