| Basic information from miRBase |
| hairpin accession number: MI0008654 |
| Located between position 101477490 and 101477563 on chromosome 14 strand + |
| mature miRNAs for MI0008654: |
| ptr-miR-381 (MIMAT0008133): TATACAAGGGCAAGCTCTCTGT |
| You can find this miRNA in ENTREZGENE: MIR381 (accession: 100316542) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |