Basic information from miRBase |
hairpin accession number: MI0008596 |
Located between position 101472937 and 101473018 on chromosome 14 strand + |
mature miRNAs for MI0008596: |
ptr-miR-300 (MIMAT0008083): TATACAAGGGCAGACTCTCTCT |
You can find this miRNA in ENTREZGENE: MIR300 (accession: 100316130) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |