| Basic information from miRBase |
| hairpin accession number: MI0017758 |
| Located between position 3636967 and 3637073 on chromosome 2L strand - |
| Overlapping with sense strand of for-RB (intron 1). |
| (Ensemble: FBtr0089305) (FlyBase: FlyBase) |
| mature miRNAs for MI0017758: |
| dme-miR-4972-5p (MIMAT0020199): CCTCGGCTTTACAGATATATAT |
| dme-miR-4972-3p (MIMAT0020200): TATATCTGTGCGATCGGGATTG |
| References |
| [1]Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC, Genome Res. 21:203-215(2011)., "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" |