| Basic information from miRBase |
| hairpin accession number: MI0013443 |
| Located between position 888581 and 888677 on chromosome CH477453.1 strand - |
| mature miRNAs for MI0013443: |
| aae-miR-2a* (MIMAT0014225): ACTCTCAAAGTGGTTGTGAAA |
| aae-miR-2a (MIMAT0014226): TATCACAGCCAGCTTTGAAGAGC |
| References |
| [1]Li S, Mead EA, Liang S, Tu Z, BMC Genomics. 10:581(2009)., "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" |
| [2]Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR, BMC Genomics. 11:119(2010)., "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" |