miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000431

Located between position 11243466 and 11243567 on chromosome 3R strand -

mature miRNAs for MI0000431:

dme-miR-2c-5p (MIMAT0020845): TCATCAAAAAGGGCTGAAGAAAGAT

dme-miR-2c-3p (MIMAT0000411): TATCACAGCCAGCTTTGATGGGC

You can find this miRNA in TARGETS:MIRTE: miR-2c (accession: miR-2c)

References

[1]Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V, Dev Biol. 259:9-18(2003)., "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity"

[2]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"

[3]Stark A, Brennecke J, Russell RB, Cohen SM, PLoS Biol. 1:E60(2003)., "Identification of Drosophila MicroRNA targets"

[4]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"

[5]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"

more data

Data from CoGemiR